cvpA Gene Page

Genbank name: cvpA
EcoGene name: cvpA
Divergent gene:
Species with an ortholog: EC   HI   PA   SP   ST   VC   YP   
EcoGene link: EG10169
   Reported site,genomic coordinates and site type: DPInteract 2428835:2428860 purR

Species that contributed to the solution: EC HI ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 45.99
Model logo: cvpA.1.model.LGO.gif
Sequence logo: cvpA.1.LGO.gif
Sequence Alignment: cvpA.1.ALGN
Solution location in genomic coordinates: 2428840-2428855 R
Solution sequence with flanking nucleotides: tccct ACGCAAACGTTTTCTT tttct
Number of overlapping basepairs with reported site: 16
Site type: purR

Species that contributed to the solution: EC HI ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 28.93
Model logo: cvpA.2.model.LGO.gif
Sequence logo: cvpA.2.LGO.gif
Sequence Alignment: cvpA.2.ALGN
Solution location in genomic coordinates: 2428881-2428904 R
Solution sequence with flanking nucleotides: gcgtt GAATATTTTTTCAGCGCCATTTTT attga
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: cvpA_REP169a_IR     Overlap: 20
Solution location in genomic coordinates: 2428842-2428865 R
Solution sequence with flanking nucleotides: gggaa GGAAATCCCTACGCAAACGTTTTC ttttt
Number of overlapping basepairs with reported site: 19
Site type: purR

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 20.45
Model logo: cvpA.3.model.LGO.gif
Sequence logo: cvpA.3.LGO.gif
Sequence Alignment: cvpA.3.ALGN
Solution location in genomic coordinates: 2428817-2428838 R
Solution sequence with flanking nucleotides: tcttt TTCTGTTAGAATGCGCCCCGAA cagga
Number of overlapping basepairs with reported site: 4
Site type: purR


Gene Index Page