cyaA Gene Page

Genbank name: cyaA
EcoGene name: cyaA
Divergent gene: hemC
Species with an ortholog: AA EC HI PA SP ST VC YP
EcoGene link: EG10170 Reported site,genomic coordinates and site type: DPInteract 3988594:3988615 crp

Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 39.80
Model logo: cyaA.1.model.LGO.gif
Sequence logo: cyaA.1.LGO.gif
Sequence Alignment: cyaA.1.ALGN
Solution location in genomic coordinates: 3988593-3988616
Solution sequence with flanking nucleotides: tcagc AAGGTGTTAAATTGATCACGTTTT agacc
Number of overlapping basepairs with reported site: 22
Site type: crp

Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 2
Map value: 17.44
Model logo: cyaA.2.model.LGO.gif
Sequence logo: cyaA.2.LGO.gif
Sequence Alignment: cyaA.2.ALGN
Solution location in genomic coordinates: 3988541-3988563
Solution sequence with flanking nucleotides: agaga ATAAACGGTGCTACACTTGTATG tagcg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3988589-3988611
Solution sequence with flanking nucleotides: tcaat CAGCAAGGTGTTAAATTGATCAC gtttt
Number of overlapping basepairs with reported site: 18
Site type: crp

Species that contributed to the solution: AA EC ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 11.13
Model logo: cyaA.3.model.LGO.gif
Sequence logo: cyaA.3.LGO.gif
Sequence Alignment: cyaA.3.ALGN
Solution location in genomic coordinates: 3988623-3988646
Solution sequence with flanking nucleotides: gacca TTTTTTCGTCGTGAAACTAAAAAA accag
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page