cyaY Gene Page

Genbank name: cyaY
EcoGene name: cyaY
Divergent gene: b3808
Species with an ortholog: EC   HI   PA   SP   ST   VC   YP   
EcoGene link: EG11653

Species that contributed to the solution: EC HI PA SP VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 7.97
Model logo: cyaY.1.model.LGO.gif
Sequence logo: cyaY.1.LGO.gif
Sequence Alignment: cyaY.1.ALGN
Solution location in genomic coordinates: 3991698-3991721 R
Solution sequence with flanking nucleotides: gccct GACCCCATGCCGCTATACTGCCGC catca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 6.60
Model logo: cyaY.2.model.LGO.gif
Sequence logo: cyaY.2.LGO.gif
Sequence Alignment: cyaY.2.ALGN
Solution location in genomic coordinates: 3991931-3991948 R
Solution sequence with flanking nucleotides: tggct TTATGCACTATCGCAATG tggtt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3991766-3991783 R
Solution sequence with flanking nucleotides: atcat TATTCCGGTGACGGATGA atcgt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 6.16
Model logo: cyaY.3.model.LGO.gif
Sequence logo: cyaY.3.LGO.gif
Sequence Alignment: cyaY.3.ALGN
Solution location in genomic coordinates: 3991840-3991863 R
Solution sequence with flanking nucleotides: cataa TGTTTACCAGAAACAGGGAAAGAC gtggt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: cyaY_yifL_IR     Overlap: 8


Gene Index Page