cydA Gene Page

Genbank name: cydA
EcoGene name: cydA
Divergent gene:
Species with an ortholog: EC   HI   SP   ST   VC   YP   
EcoGene link: EG10173
   Reported site,genomic coordinates and site type: DPInteract 770304:770318 arcA
   Reported site,genomic coordinates and site type: DPInteract 770519:770533 arcA
   Reported site,genomic coordinates and site type: DPInteract 770071:770085 arcA
   Reported site,genomic coordinates and site type: DPInteract 770093:770107 arcA
   Reported site,genomic coordinates and site type: DPInteract 770381:770402 fnr
   Reported site,genomic coordinates and site type: DPInteract 770426:770447 fnr

Species that contributed to the solution: EC HI ST VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 38.51
Model logo: cydA.1.model.LGO.gif
Sequence logo: cydA.1.LGO.gif
Sequence Alignment: cydA.1.ALGN
Solution location in genomic coordinates: 770330-770349
Solution sequence with flanking nucleotides: tgtag GAATTGATATTTATCAATGT ataag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 770382-770401
Solution sequence with flanking nucleotides: gagat AAATTGTTCTCGATCAAATT ggctg
Number of overlapping basepairs with reported site: 20
Site type: fnr

Species that contributed to the solution: EC HI ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 22.31
Model logo: cydA.2.model.LGO.gif
Sequence logo: cydA.2.LGO.gif
Sequence Alignment: cydA.2.ALGN
Solution location in genomic coordinates: 770467-770489
Solution sequence with flanking nucleotides: aacaa AAACCTGTTTATTGTAAGGATTT tgcgg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 15.88
Model logo: cydA.3.model.LGO.gif
Sequence logo: cydA.3.LGO.gif
Sequence Alignment: cydA.3.ALGN
Solution location in genomic coordinates: 770280-770303
Solution sequence with flanking nucleotides: aaaca TAAATGTCACTAAAGTTACCTTAT tgaaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 770305-770328
Solution sequence with flanking nucleotides: ttatt GAAACATGATTAACATAATTTGTA ggaat
Number of overlapping basepairs with reported site: 14
Site type: arcA


Gene Index Page