cydD Gene Page

Genbank name: cydD
EcoGene name: cydD
Divergent gene:
Species with an ortholog: AA EC HI SP ST VC YP
EcoGene link: EG11405

Species that contributed to the solution: AA EC SP ST YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 29.49
Model logo: cydD.1.model.LGO.gif
Sequence logo: cydD.1.LGO.gif
Sequence Alignment: cydD.1.ALGN
Solution location in genomic coordinates: 930288-930309 R
Solution sequence with flanking nucleotides: t AATTTTACAAATCAGTAACAAA agtaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 930227-930248 R
Solution sequence with flanking nucleotides: ccttt ATTTTTTCCCCGTTGTAACATT gctct
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI SP ST
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 25.84
Model logo: cydD.2.model.LGO.gif
Sequence logo: cydD.2.LGO.gif
Sequence Alignment: cydD.2.ALGN
Solution location in genomic coordinates: 930287-930307 R
Solution sequence with flanking nucleotides: taa TTTTACAAATCAGTAACAAAA gtaaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 930205-930225 R
Solution sequence with flanking nucleotides: cattg CTCTGCAAATAATTCTGATAA ctcac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 11.90
Model logo: cydD.3.model.LGO.gif
Sequence logo: cydD.3.LGO.gif
Sequence Alignment: cydD.3.ALGN
Solution location in genomic coordinates: 930251-930269 R
Solution sequence with flanking nucleotides: acacc ATGCGACTATGGGTCGCCT ttatt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page