cynR Gene Page

Genbank name: cynR
EcoGene name: cynR
Divergent gene: cynT
Species with an ortholog: EC   PA   ST   TF   VC   YP
EcoGene link: EG11421    Reported site,genomic coordinates and site type: DPInteract 357953:357973 cynR
   Reported site,genomic coordinates and site type: DPInteract 357921:357941 cynR

Species that contributed to the solution: EC ST TF VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 6.11
Model logo: cynR.1.model.LGO.gif
Sequence logo: cynR.1.LGO.gif
Sequence Alignment: cynR.1.ALGN
Solution location in genomic coordinates: 357946-357967 R
Solution sequence with flanking nucleotides: tcata AGGTAAAAGTCTCATTTATGAT gagtt
Number of overlapping basepairs with reported site: 15
Site type: cynR

Species that contributed to the solution: EC PA ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 3.45
Model logo: cynR.2.model.LGO.gif
Sequence logo: cynR.2.LGO.gif
Sequence Alignment: cynR.2.ALGN
Solution location in genomic coordinates: 357960-357978 R
Solution sequence with flanking nucleotides: ctcgc CGATTGTCATAAGGTAAAA gtctc
Number of overlapping basepairs with reported site: 14
Site type: cynR
Solution location in genomic coordinates: 357922-357940 R
Solution sequence with flanking nucleotides: gagtt CCATTGGATTTACTTATAG gttgc
Number of overlapping basepairs with reported site: 19
Site type: cynR

Species that contributed to the solution: EC PA TF VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 3.35
Model logo: cynR.3.model.LGO.gif
Sequence logo: cynR.3.LGO.gif
Sequence Alignment: cynR.3.ALGN
Solution location in genomic coordinates: 357996-358014 R
Solution sequence with flanking nucleotides: taacc TCTGTCTGTCTCTGGAATG agagg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page