cynT Gene Page
Genbank name: cynT
EcoGene name: cynT
Divergent gene: cynR
Species with an ortholog:
AA EC PA TF
EcoGene link: EG10176
Species that contributed to the solution: AA EC PA
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 3.94
Model logo: cynT.1.model.LGO.gif
Sequence logo: cynT.1.LGO.gif
Sequence Alignment: cynT.1.ALGN
Solution location in genomic coordinates: 357916-357939
Solution sequence with flanking nucleotides: t CGCAACCTATAAGTAAATCCAATG gaact
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 357948-357971
Solution sequence with flanking nucleotides: ctcat CATAAATGAGACTTTTACCTTATG acaat
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: 2.37
Model logo: cynT.2.model.LGO.gif
Sequence logo:
Sequence Alignment: cynT.2.ALGN
Solution location in genomic coordinates: 357987-358010
Solution sequence with flanking nucleotides: agtag TCTGCCTCTCATTCCAGAGACAGA cagag
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page