cyoA Gene Page
Genbank name: cyoA
EcoGene name: cyoA
Divergent gene:
Species with an ortholog:
EC PA ST TF YP
EcoGene link: EG10178
Species that contributed to the solution: EC ST TF YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 23.22
Model logo: cyoA.1.model.LGO.gif
Sequence logo: cyoA.1.LGO.gif
Sequence Alignment: cyoA.1.ALGN
Solution location in genomic coordinates: 451233-451254 R
Solution sequence with flanking nucleotides: ccgta ATTATTACGGCTAAATAAACAT cagta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: cyoA_ampG_IR2     Overlap: 18
Solution location in genomic coordinates: 450894-450915 R
Solution sequence with flanking nucleotides: taatc ATGTTTACAGTAATGTAACCTT cccgt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 16.05
Model logo: cyoA.2.model.LGO.gif
Sequence logo: cyoA.2.LGO.gif
Sequence Alignment: cyoA.2.ALGN
Solution location in genomic coordinates: 450869-450890 R
Solution sequence with flanking nucleotides: ttccc GTAAAATGCCCACACACTTTAA acgcc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA ST TF YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 14.11
Model logo: cyoA.3.model.LGO.gif
Sequence logo: cyoA.3.LGO.gif
Sequence Alignment: cyoA.3.ALGN
Solution location in genomic coordinates: 451272-451294 R
Solution sequence with flanking nucleotides: ta ATCTGTAAATATTATTTAGCTGT agtaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: cyoA_ampG_IR2     Overlap: 12
Solution location in genomic coordinates: 451065-451087 R
Solution sequence with flanking nucleotides: aatta TTTGTTAAATAATTGTTTTATTT cacat
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page