cysB Gene Page
Genbank name: cysB
EcoGene name: cysB
Divergent gene:
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10184
Reported site,genomic coordinates and site type: DPInteract 1331778:1331817 cysB
Species that contributed to the solution: AA EC HI PA SP ST VC YP
Total number of sites in the solution: 13
Number of E. coli sites in the solution: 2
Map value: 23.63
Model logo: cysB.1.model.LGO.gif
Sequence logo: cysB.1.LGO.gif
Sequence Alignment: cysB.1.ALGN
Solution location in genomic coordinates: 1331765-1331784
Solution sequence with flanking nucleotides: aggct ATAAATGATATAGTGGTTAT agtta
Number of overlapping basepairs with reported site: 7
Site type: cysB
Repeat: topA_cysB_IR     Overlap: 20
Solution location in genomic coordinates: 1331798-1331817
Solution sequence with flanking nucleotides: ccttt TTTATTATTAAATCGTATTA gtcac
Number of overlapping basepairs with reported site: 20
Site type: cysB
Repeat: topA_cysB_IR     Overlap: 20
Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 1
Map value: 10.26
Model logo: cysB.2.model.LGO.gif
Sequence logo: cysB.2.LGO.gif
Sequence Alignment: cysB.2.ALGN
Solution location in genomic coordinates: 1331672-1331695
Solution sequence with flanking nucleotides: taacc TTTAATTCTGTCAGGTTTTTATAA acaaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA SP ST TF VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 7.66
Model logo: cysB.3.model.LGO.gif
Sequence logo: cysB.3.LGO.gif
Sequence Alignment: cysB.3.ALGN
Solution location in genomic coordinates: 1331698-1331721
Solution sequence with flanking nucleotides: taaac AAAGGGTCGCGAAAGCGGCCCTTT tttat
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page