cysD Gene Page
Genbank name: cysD
EcoGene name: cysD
Divergent gene: iap
Species with an ortholog:
EC PA SP ST TF VC YP
EcoGene link: EG10186
Species that contributed to the solution: EC PA ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 9.79
Model logo: cysD.1.model.LGO.gif
Sequence logo: cysD.1.LGO.gif
Sequence Alignment: cysD.1.ALGN
Solution location in genomic coordinates: 2874482-2874501 R
Solution sequence with flanking nucleotides: cggtg CCTTAAGCACTTTTTGATAT tagct
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2874440-2874459 R
Solution sequence with flanking nucleotides: tattc CGTTAAGGAACTACTCATTC taatt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 6.14
Model logo: cysD.2.model.LGO.gif
Sequence logo: cysD.2.LGO.gif
Sequence Alignment: cysD.2.ALGN
Solution location in genomic coordinates: 2874507-2874529 R
Solution sequence with flanking nucleotides: tttca AATCTTCCTAAACGCCCGAAATC cggtg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2874391-2874413 R
Solution sequence with flanking nucleotides: ctctt ACGCTCCCTATAGTCGAAACATC tgatg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST TF
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 5.68
Model logo: cysD.3.model.LGO.gif
Sequence logo: cysD.3.LGO.gif
Sequence Alignment: cysD.3.ALGN
Solution location in genomic coordinates: 2874354-2874375 R
Solution sequence with flanking nucleotides: aaaat AGCGGTATTGCAAAGGAACGGT t
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page