cysE Gene Page

Genbank name: cysE
EcoGene name: cysE
Divergent gene:
Species with an ortholog: AA EC HI ST VC YP
EcoGene link: EG10187

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 10.05
Model logo: cysE.1.model.LGO.gif
Sequence logo: cysE.1.LGO.gif
Sequence Alignment: cysE.1.ALGN
Solution location in genomic coordinates: 3780217-3780239 R
Solution sequence with flanking nucleotides: atgac CCGGCCCGCGCAGAACGGGCCGG tcatt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.96
Model logo: cysE.2.model.LGO.gif
Sequence logo: cysE.2.LGO.gif
Sequence Alignment: cysE.2.ALGN
Solution location in genomic coordinates: 3780191-3780214 R
Solution sequence with flanking nucleotides: cggtc ATTATCTCATCGTGTGGAGTAAGC a
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page