cysJ Gene Page

Genbank name: cysJ
EcoGene name: cysJ
Divergent gene: ygcM
Species with an ortholog: EC   SP   ST   TF   VC   YP   
EcoGene link: EG10191

Species that contributed to the solution: EC SP ST TF YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 15.14
Model logo: cysJ.1.model.LGO.gif
Sequence logo: cysJ.1.LGO.gif
Sequence Alignment: cysJ.1.ALGN
Solution location in genomic coordinates: 2890108-2890131 R
Solution sequence with flanking nucleotides: taatg ATTGGCTAAATTCATTTGTTTTTC attag
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: cysJ_ygcM_IR     Overlap: 24
Solution location in genomic coordinates: 2890041-2890064 R
Solution sequence with flanking nucleotides: gctaa AACAGGTTAGTCGATTTGGTTATT agtta
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST TF VC YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 2
Map value: 12.73
Model logo: cysJ.2.model.LGO.gif
Sequence logo: cysJ.2.LGO.gif
Sequence Alignment: cysJ.2.ALGN
Solution location in genomic coordinates: 2890166-2890188 R
Solution sequence with flanking nucleotides: ggctg TTTTTTCGCATTATCTAAAACGA ctttg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2890026-2890048 R
Solution sequence with flanking nucleotides: cgatt TGGTTATTAGTTATCGCTATCCC gtctt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 12.24
Model logo: cysJ.3.model.LGO.gif
Sequence logo: cysJ.3.LGO.gif
Sequence Alignment: cysJ.3.ALGN
Solution location in genomic coordinates: 2890136-2890154 R
Solution sequence with flanking nucleotides: tgcgc AAAATCGCTGATTTATCTT aatga
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: cysJ_ygcM_IR     Overlap: 19
Solution location in genomic coordinates: 2890048-2890066 R
Solution sequence with flanking nucleotides: ttgct AAAACAGGTTAGTCGATTT ggtta
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page