cysK Gene Page

Genbank name: cysK
EcoGene name: cysK
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10192
   Reported site,genomic coordinates and site type: DPInteract 2530280:2530319 cysB
   Reported site,genomic coordinates and site type: DPInteract 2530324:2530363 cysB

Species that contributed to the solution: AA EC HI ST TF YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 22.42
Model logo: cysK.1.model.LGO.gif
Sequence logo: cysK.1.LGO.gif
Sequence Alignment: cysK.1.ALGN
Solution location in genomic coordinates: 2530339-2530361
Solution sequence with flanking nucleotides: tctgt ATATAGATATGCTAAATCCTTAC ttccg
Number of overlapping basepairs with reported site: 23
Site type: cysB

Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 15.02
Model logo: cysK.2.model.LGO.gif
Sequence logo: cysK.2.LGO.gif
Sequence Alignment: cysK.2.ALGN
Solution location in genomic coordinates: 2530330-2530349
Solution sequence with flanking nucleotides: tattt CCCTTCTGTATATAGATATG ctaaa
Number of overlapping basepairs with reported site: 20
Site type: cysB
Solution location in genomic coordinates: 2530401-2530420
Solution sequence with flanking nucleotides: tgtat CCCAATTTCATACAGTTAAG gacag
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI PA ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 8.98
Model logo: cysK.3.model.LGO.gif
Sequence logo: cysK.3.LGO.gif
Sequence Alignment: cysK.3.ALGN
Solution location in genomic coordinates: 2530372-2530390
Solution sequence with flanking nucleotides: catat TCTCTGAGCGGGTATGCTA cctgt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2530406-2530424
Solution sequence with flanking nucleotides: cccaa TTTCATACAGTTAAGGACA ggcc
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page