cysM Gene Page

Genbank name: cysM
EcoGene name: cysM
Divergent gene:
Species with an ortholog: EC PA SP ST TF VC YP
EcoGene link: EG10193

Species that contributed to the solution: EC PA SP ST TF YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 8.01
Model logo: cysM.1.model.LGO.gif
Sequence logo: cysM.1.LGO.gif
Sequence Alignment: cysM.1.ALGN
Solution location in genomic coordinates: 2537701-2537720 R
Solution sequence with flanking nucleotides: aatgt TAAACGCCCGGAGGCGCTTC ccgcg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 4.34
Model logo: cysM.2.model.LGO.gif
Sequence logo: cysM.2.LGO.gif
Sequence Alignment: cysM.2.ALGN
Solution location in genomic coordinates: 2537650-2537669 R
Solution sequence with flanking nucleotides: ggttt GTAACCTGTAGACCTGATAA gacgc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP175 Overlap: 13

Gene Index Page