cysQ Gene Page
Genbank name: cysQ
EcoGene name: cysQ
Divergent gene: cpdB
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10043
Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 11.95
Model logo: cysQ.1.model.LGO.gif
Sequence logo: cysQ.1.LGO.gif
Sequence Alignment: cysQ.1.ALGN
Solution location in genomic coordinates: 4434156-4434176
Solution sequence with flanking nucleotides: atcct TTTATCATCGGGAATACGAAA gaaaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4434272-4434292
Solution sequence with flanking nucleotides: attca TTAACGATAGGGTATAAGTAA aacaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI PA SP ST YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 6.63
Model logo: cysQ.2.model.LGO.gif
Sequence logo: cysQ.2.LGO.gif
Sequence Alignment: cysQ.2.ALGN
Solution location in genomic coordinates: 4434243-4434265
Solution sequence with flanking nucleotides: gaaaa TGATGACACTATCACAGTTGGCG cattc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI SP VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 5.99
Model logo: cysQ.3.model.LGO.gif
Sequence logo: cysQ.3.LGO.gif
Sequence Alignment: cysQ.3.ALGN
Solution location in genomic coordinates: 4434195-4434213
Solution sequence with flanking nucleotides: aaacg TCTTACTTATAGAACAGTG aagaa
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page