cysS Gene Page

Genbank name: cysS
EcoGene name: cysS
Divergent gene: ppiB
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10196

Species that contributed to the solution: AA EC HI SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 11.72
Model logo: cysS.1.model.LGO.gif
Sequence logo: cysS.1.LGO.gif
Sequence Alignment: cysS.1.ALGN
Solution location in genomic coordinates: 553712-553734
Solution sequence with flanking nucleotides: catat ATAGGGTGGTGTTATAGCATAAC cgcac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 11.25
Model logo: cysS.2.model.LGO.gif
Sequence logo: cysS.2.LGO.gif
Sequence Alignment: cysS.2.ALGN
Solution location in genomic coordinates: 553804-553827
Solution sequence with flanking nucleotides: ctcaa TTACCCACACATGTCTAAACGGAA tcttc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 10.18
Model logo: cysS.3.model.LGO.gif
Sequence logo: cysS.3.LGO.gif
Sequence Alignment: cysS.3.ALGN
Solution location in genomic coordinates: 553781-553799
Solution sequence with flanking nucleotides: ggaaa TATGGGTATTATACGCAAC tcaat
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page