cysZ Gene Page

Solution location in genomic coordinates: 2529366-2529389
Solution sequence with flanking nucleotides: aagat AGATGAAATCGTGCTTTTTGCTGT ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: zipA_cysZ_IR     Overlap: 24

---

Species that contributed to the solution: EC PA SP ST YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 15.52
Model logo: cysZ.2.model.LGO.gif
Sequence logo: cysZ.2.LGO.gif
Sequence Alignment: cysZ.2.ALGN
Solution location in genomic coordinates: 2529275-2529296
Solution sequence with flanking nucleotides: ctaac ACCTTGCCACCACGGCAAACAT ttact
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2529310-2529331
Solution sequence with flanking nucleotides: taaga GTATTTGCCGATTACCTCAAGT gcaag
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 14.46
Model logo: cysZ.3.model.LGO.gif
Sequence logo: cysZ.3.LGO.gif
Sequence Alignment: cysZ.3.ALGN
Solution location in genomic coordinates: 2529259-2529282
Solution sequence with flanking nucleotides: tatat TCTCTGTTGTTCTAACACCTTGCC accac
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2529384-2529407
Solution sequence with flanking nucleotides: ctttt TGCTGTTTTTTCGAACATATCCTA actgt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: zipA_cysZ_IR     Overlap: 6


Gene Index Page