dadA Gene Page
Genbank name: dadA
EcoGene name: dadA
Divergent gene: ycgB
Species with an ortholog:
EC PA ST VC YP
EcoGene link: EG11407
Reported site,genomic coordinates and site type: DPInteract 1236678:1236699 crp
Reported site,genomic coordinates and site type: DPInteract 1236741:1236762 crp
Reported site,genomic coordinates and site type: PMID:10216857 1236475:1236488 lrp
Reported site,genomic coordinates and site type: PMID:10216857 1236496:1236524 lrp
Reported site,genomic coordinates and site type: PMID:10216857 1236537:1236563 lrp
Reported site,genomic coordinates and site type: PMID:10216857 1236576:1236592 lrp
Reported site,genomic coordinates and site type: PMID:10216857 1236598:1236627 lrp
Reported site,genomic coordinates and site type: PMID:10216857 1236632:1236655 lrp
Reported site,genomic coordinates and site type: PMID:10216857 1236674:1236698 lrp
Reported site,genomic coordinates and site type: PMID:10216857 1236718:1236737 lrp
Reported site,genomic coordinates and site type: PMID:10216857 1236746:1236769 lrp
Reported site,genomic coordinates and site type: PMID:10216857 1236794:1236817 lrp
Reported site,genomic coordinates and site type: PMID:10216857 1236823:1236831 lrp
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 14.37
Model logo: dadA.1.model.LGO.gif
Sequence logo: dadA.1.LGO.gif
Sequence Alignment: dadA.1.ALGN
Solution location in genomic coordinates: 1236601-1236623
Solution sequence with flanking nucleotides: gcttc TGAACGGAATTTTATGCTGGATA aaaag
Number of overlapping basepairs with reported site: 23
Site type: lrp
Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 14.18
Model logo: dadA.2.model.LGO.gif
Sequence logo: dadA.2.LGO.gif
Sequence Alignment: dadA.2.ALGN
Solution location in genomic coordinates: 1236711-1236731
Solution sequence with flanking nucleotides: ccgca TGTTGAATAATATTTTCAACT gagtt
Number of overlapping basepairs with reported site: 14
Site type: lrp
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 13.33
Model logo: dadA.3.model.LGO.gif
Sequence logo: dadA.3.LGO.gif
Sequence Alignment: dadA.3.ALGN
Solution location in genomic coordinates: 1236510-1236532
Solution sequence with flanking nucleotides: cctca TTTCAAGCATAGAACACCTGTTA aaaac
Number of overlapping basepairs with reported site: 15
Site type: lrp
Repeat: TERM19     Overlap: 3
Solution location in genomic coordinates: 1236601-1236623
Solution sequence with flanking nucleotides: gcttc TGAACGGAATTTTATGCTGGATA aaaag
Number of overlapping basepairs with reported site: 23
Site type: lrp
Gene Index Page