dam Gene Page
Genbank name: dam
EcoGene name: dam
Divergent gene:
Species with an ortholog:
AA EC HI SP ST VC YP
EcoGene link: EG10204
Species that contributed to the solution: EC SP ST VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 13.46
Model logo: dam.1.model.LGO.gif
Sequence logo: dam.1.LGO.gif
Sequence Alignment: dam.1.ALGN
Solution location in genomic coordinates: 3513579-3513601 R
Solution sequence with flanking nucleotides: tggat GCTGTCGGAGCTTTCTCCACAGC cggag
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 9.50
Model logo: dam.2.model.LGO.gif
Sequence logo: dam.2.LGO.gif
Sequence Alignment: dam.2.ALGN
Solution location in genomic coordinates: 3513604-3513625 R
Solution sequence with flanking nucleotides: cgttg CGGGAGTTGCCTGAAGCGCTGG atgct
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: dam_damX_IR     Overlap: 8
Solution location in genomic coordinates: 3513576-3513597 R
Solution sequence with flanking nucleotides: tgctg TCGGAGCTTTCTCCACAGCCGG agaag
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI ST VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 8.33
Model logo: dam.3.model.LGO.gif
Sequence logo: dam.3.LGO.gif
Sequence Alignment: dam.3.ALGN
Solution location in genomic coordinates: 3513555-3513571 R
Solution sequence with flanking nucleotides: gagaa GGTGTAATTAGTTAGTC agc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page