dapA Gene Page
Genbank name: dapA
EcoGene name: dapA
Divergent gene: gcvR
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10205
Species that contributed to the solution: AA EC HI SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 13.37
Model logo: dapA.1.model.LGO.gif
Sequence logo: dapA.1.LGO.gif
Sequence Alignment: dapA.1.ALGN
Solution location in genomic coordinates: 2597819-2597841 R
Solution sequence with flanking nucleotides: gtctg CTTGCTTTTAATGCCATACCAAA cgtac
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 10.57
Model logo: dapA.2.model.LGO.gif
Sequence logo: dapA.2.LGO.gif
Sequence Alignment: dapA.2.ALGN
Solution location in genomic coordinates: 2597796-2597813 R
Solution sequence with flanking nucleotides: cgtac CATTGAGACACTTGTTTG cacag
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI PA SP ST TF
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 5.11
Model logo: dapA.3.model.LGO.gif
Sequence logo: dapA.3.LGO.gif
Sequence Alignment: dapA.3.ALGN
Solution location in genomic coordinates: 2597843-2597859 R
Solution sequence with flanking nucleotides: TCAGAACGGTTCTGTCT gcttg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page