dapB Gene Page
Genbank name: dapB
EcoGene name: dapB
Divergent gene:
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10206
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 16.28
Model logo: dapB.1.model.LGO.gif
Sequence logo: dapB.1.LGO.gif
Sequence Alignment: dapB.1.ALGN
Solution location in genomic coordinates: 28247-28267
Solution sequence with flanking nucleotides: gactc ATGCCTTTCACTGATATCCCT ccctg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 28325-28345
Solution sequence with flanking nucleotides: gatgc GCTGGTTACTCTGAAAACGGT ctatg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI SP ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 12.88
Model logo: dapB.2.model.LGO.gif
Sequence logo: dapB.2.LGO.gif
Sequence Alignment: dapB.2.ALGN
Solution location in genomic coordinates: 28276-28298
Solution sequence with flanking nucleotides: tgttt ATCATTAATTTCTAATTATCAGC gtttt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI SP ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 8.40
Model logo: dapB.3.model.LGO.gif
Sequence logo: dapB.3.LGO.gif
Sequence Alignment: dapB.3.ALGN
Solution location in genomic coordinates: 28353-28369
Solution sequence with flanking nucleotides: atgca AATTAACAAAAGAGAAT agct
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page