dapF Gene Page

Genbank name: dapF
EcoGene name: dapF
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG10209

Species that contributed to the solution: EC HI PA SP ST TF VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 1
Map value: 15.26
Model logo: dapF.1.model.LGO.gif
Sequence logo: dapF.1.LGO.gif
Sequence Alignment: dapF.1.ALGN
Solution location in genomic coordinates: 3992214-3992233
Solution sequence with flanking nucleotides: gctct ATTTCCCGCCTGCAGATAAA aacgc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI SP ST VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 13.53
Model logo: dapF.2.model.LGO.gif
Sequence logo: dapF.2.LGO.gif
Sequence Alignment: dapF.2.ALGN
Solution location in genomic coordinates: 3992286-3992302
Solution sequence with flanking nucleotides: ggtgc CGGATAAAAACGATCGC gccac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP ST TF VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 12.87
Model logo: dapF.3.model.LGO.gif
Sequence logo: dapF.3.LGO.gif
Sequence Alignment: dapF.3.ALGN
Solution location in genomic coordinates: 3992174-3992190
Solution sequence with flanking nucleotides: ttact CTCTTCAGCCTGACGGG ctgcg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page