dbpA Gene Page

Genbank name: dbpA
EcoGene name: dbpA
Divergent gene:
Species with an ortholog: EC PA SP ST TF VC YP
EcoGene link: EG10210

Species that contributed to the solution: EC PA ST TF YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 11.15
Model logo: dbpA.1.model.LGO.gif
Sequence logo: dbpA.1.LGO.gif
Sequence Alignment: dbpA.1.ALGN
Solution location in genomic coordinates: 1407482-1407498
Solution sequence with flanking nucleotides: gtaga TCTGCGAGGATACGCGC ctgct
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 10.79
Model logo: dbpA.2.model.LGO.gif
Sequence logo: dbpA.2.LGO.gif
Sequence Alignment: dbpA.2.ALGN
Solution location in genomic coordinates: 1407086-1407109
Solution sequence with flanking nucleotides: tgtat ACAAAAACGCCGCAAAGTTTGAGC gaagt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1407160-1407183
Solution sequence with flanking nucleotides: aggtg AATGCAACGTCAAGCGATGGGCGT tgcgc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST TF VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 9.81
Model logo: dbpA.3.model.LGO.gif
Sequence logo: dbpA.3.LGO.gif
Sequence Alignment: dbpA.3.ALGN
Solution location in genomic coordinates: 1407447-1407469
Solution sequence with flanking nucleotides: cgatg AAGAACCGATTAAATTGTCGCAT cgtga
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page