dcd Gene Page

Genbank name: dcd
EcoGene name: dcd
Divergent gene:
Species with an ortholog: AA   EC   HI   SP   ST   YP   
EcoGene link: EG11418

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 10.47
Model logo: dcd.1.model.LGO.gif
Sequence logo: dcd.1.LGO.gif
Sequence Alignment: dcd.1.ALGN
Solution location in genomic coordinates: 2140307-2140327 R
Solution sequence with flanking nucleotides: taag CTTGATAAATTGTGTACCGTT cagtg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 9.65
Model logo: dcd.2.model.LGO.gif
Sequence logo: dcd.2.LGO.gif
Sequence Alignment: dcd.2.ALGN
Solution location in genomic coordinates: 2140274-2140292 R
Solution sequence with flanking nucleotides: cctag TATGCCCTTGACGTAATTG gcgtt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2140251-2140269 R
Solution sequence with flanking nucleotides: ggcgt TAAGGGAGTGATGCGCGAA aggag
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 8.51
Model logo: dcd.3.model.LGO.gif
Sequence logo: dcd.3.LGO.gif
Sequence Alignment: dcd.3.ALGN
Solution location in genomic coordinates: 2140295-2140318 R
Solution sequence with flanking nucleotides: ataaa TTGTGTACCGTTCAGTGATAACCT agtat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2140241-2140264 R
Solution sequence with flanking nucleotides: taagg GAGTGATGCGCGAAAGGAGAAAAT gcc
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page