dcuA Gene Page

Genbank name: dcuA
EcoGene name: dcuA
Divergent gene:
Species with an ortholog: EC   HI   SP   ST   VC   YP   
EcoGene link: EG11225

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 14.15
Model logo: dcuA.1.model.LGO.gif
Sequence logo: dcuA.1.LGO.gif
Sequence Alignment: dcuA.1.ALGN
Solution location in genomic coordinates: 4364449-4364470 R
Solution sequence with flanking nucleotides: t AATCGTACAGGGTAGTACAAAT aaaaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: dcuA_aspA_IR     Overlap: 3

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 13.87
Model logo: dcuA.2.model.LGO.gif
Sequence logo: dcuA.2.LGO.gif
Sequence Alignment: dcuA.2.ALGN
Solution location in genomic coordinates: 4364403-4364426 R
Solution sequence with flanking nucleotides: tgacg TGCCTTTTTTCTTGTGAGCAGTAA cttaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: dcuA_aspA_IR     Overlap: 13
Solution location in genomic coordinates: 4364360-4364383 R
Solution sequence with flanking nucleotides: tctaa TATCAACTTGTTAAAAAACAAGGA aggct
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.60
Model logo: dcuA.3.model.LGO.gif
Sequence logo: dcuA.3.LGO.gif
Sequence Alignment: dcuA.3.ALGN
Solution location in genomic coordinates: 4364384-4364402 R
Solution sequence with flanking nucleotides: agtaa CTTAAAAATAACAATCTAA tatca
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page