dcuB Gene Page

Genbank name: dcuB
EcoGene name: dcuB
Divergent gene:
Species with an ortholog: AA EC HI SP ST VC
EcoGene link: EG10006

Species that contributed to the solution: AA EC HI SP ST VC
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 11.35
Model logo: dcuB.1.model.LGO.gif
Sequence logo: dcuB.1.LGO.gif
Sequence Alignment: dcuB.1.ALGN
Solution location in genomic coordinates: 4346757-4346772 R
Solution sequence with flanking nucleotides: tcatc GCTAAAAATTAATATC tcttc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4346345-4346360 R
Solution sequence with flanking nucleotides: tattc AGCAAAAATTTAAATA ggatt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI SP ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 8.00
Model logo: dcuB.2.model.LGO.gif
Sequence logo: dcuB.2.LGO.gif
Sequence Alignment: dcuB.2.ALGN
Solution location in genomic coordinates: 4346365-4346387 R
Solution sequence with flanking nucleotides: catac AAAACAGAACGTGACTGTGATCT attca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI SP ST VC
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 7.08
Model logo: dcuB.3.model.LGO.gif
Sequence logo: dcuB.3.LGO.gif
Sequence Alignment: dcuB.3.ALGN
Solution location in genomic coordinates: 4346794-4346814 R
Solution sequence with flanking nucleotides: atcag TAAAACTTGTGCCAGATCAAA tataa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: dcuB_dcuR_IR Overlap: 15
Solution location in genomic coordinates: 4346472-4346492 R
Solution sequence with flanking nucleotides: agtgc ATAAATTTGCCGCTGCTTTAA tcagc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page