dcuC Gene Page

Solution location in genomic coordinates: 655368-655385 R
Solution sequence with flanking nucleotides: gcaca CATTATTATGTGATAATT gccaa
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 8.96
Model logo: dcuC.2.model.LGO.gif
Sequence logo: dcuC.2.LGO.gif
Sequence Alignment: dcuC.2.ALGN
Solution location in genomic coordinates: 655537-655556 R
Solution sequence with flanking nucleotides: aaatg CAATCAAGGAAAAATTATTT tattt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 655261-655280 R
Solution sequence with flanking nucleotides: atcag CATTCATCGCCAATTTATTG ggcat
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 8.23
Model logo: dcuC.3.model.LGO.gif
Sequence logo: dcuC.3.LGO.gif
Sequence Alignment: dcuC.3.ALGN
Solution location in genomic coordinates: 655534-655554 R
Solution sequence with flanking nucleotides: atgca ATCAAGGAAAAATTATTTTAT ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 655217-655237 R
Solution sequence with flanking nucleotides: gcttt AGGAATTTTTTATTATTTACT ttggg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page