ddlA Gene Page

Genbank name: ddlA
EcoGene name: ddlA
Divergent gene: yaiB
Species with an ortholog: AA EC HI PA ST
EcoGene link: EG10213

Species that contributed to the solution: AA EC HI ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 10.38
Model logo: ddlA.1.model.LGO.gif
Sequence logo: ddlA.1.LGO.gif
Sequence Alignment: ddlA.1.ALGN
Solution location in genomic coordinates: 400498-400521 R
Solution sequence with flanking nucleotides: caaag GAAATACTTTGCGCAAATATTTTT tgttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ddlA_yaiB_IR Overlap: 24
Solution location in genomic coordinates: 400390-400413 R
Solution sequence with flanking nucleotides: ttata AATAAAAGTTATGAAATATATTCT cttcg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 8.65
Model logo: ddlA.2.model.LGO.gif
Sequence logo: ddlA.2.LGO.gif
Sequence Alignment: ddlA.2.ALGN
Solution location in genomic coordinates: 400498-400521 R
Solution sequence with flanking nucleotides: caaag GAAATACTTTGCGCAAATATTTTT tgttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ddlA_yaiB_IR Overlap: 24
Solution location in genomic coordinates: 400311-400334 R
Solution sequence with flanking nucleotides: gccag GAATAAATTAGCTTCCCGTTCATC atttt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 8.33
Model logo: ddlA.3.model.LGO.gif
Sequence logo: ddlA.3.LGO.gif
Sequence Alignment: ddlA.3.ALGN
Solution location in genomic coordinates: 400213-400236 R
Solution sequence with flanking nucleotides: gcaga AGATTGCAACAATCTTTCAGAAGG ccgcg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page