deaD Gene Page

Genbank name: deaD
EcoGene name: deaD
Divergent gene:
Species with an ortholog: AA   EC   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10215

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 23.76
Model logo: deaD.1.model.LGO.gif
Sequence logo: deaD.1.LGO.gif
Sequence Alignment: deaD.1.ALGN
Solution location in genomic coordinates: 3305566-3305582 R
Solution sequence with flanking nucleotides: ttcac ACTTTTCAATGAAAATT gctga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 20.00
Model logo: deaD.2.model.LGO.gif
Sequence logo: deaD.2.LGO.gif
Sequence Alignment: deaD.2.ALGN
Solution location in genomic coordinates: 3305623-3305644 R
Solution sequence with flanking nucleotides: gattg CCATCACCTTAACGGGTGAGGG cgttg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 19.31
Model logo: deaD.3.model.LGO.gif
Sequence logo: deaD.3.LGO.gif
Sequence Alignment: deaD.3.ALGN
Solution location in genomic coordinates: 3305584-3305606 R
Solution sequence with flanking nucleotides: gttaa TACACCTACTTTGAGCCGGTTCA cactt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page