dedA Gene Page
Genbank name: dedA
EcoGene name: dedA
Divergent gene:
Species with an ortholog:
EC PA ST TF YP
EcoGene link: EG10216
Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 8.82
Model logo: dedA.1.model.LGO.gif
Sequence logo: dedA.1.LGO.gif
Sequence Alignment: dedA.1.ALGN
Solution location in genomic coordinates: 2432815-2432834 R
Solution sequence with flanking nucleotides: aataa TGCTCGGAACATTTCAGGCT gtagc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: dedA_truA_IR     Overlap: 20
Solution location in genomic coordinates: 2432778-2432797 R
Solution sequence with flanking nucleotides: gttac AGCCTGAAAGATGACGAGTA caagg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: dedA_truA_IR     Overlap: 20
Species that contributed to the solution: EC TF
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 4.04
Model logo: dedA.2.model.LGO.gif
Sequence logo: dedA.2.LGO.gif
Sequence Alignment: dedA.2.ALGN
Solution location in genomic coordinates: 2432798-2432814 R
Solution sequence with flanking nucleotides: aggct GTAGCCAACGTAGTTAC agcct
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: dedA_truA_IR     Overlap: 17
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.78
Model logo: dedA.3.model.LGO.gif
Sequence logo: dedA.3.LGO.gif
Sequence Alignment: dedA.3.ALGN
Solution location in genomic coordinates: 2432762-2432777 R
Solution sequence with flanking nucleotides: gagta CAAGGCATAGGCAAAT
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page