def Gene Page
Genbank name: def
EcoGene name: def
Divergent gene: smf
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG11440
Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 22.85
Model logo: def.1.model.LGO.gif
Sequence logo: def.1.LGO.gif
Sequence Alignment: def.1.ALGN
Solution location in genomic coordinates: 3431253-3431276
Solution sequence with flanking nucleotides: gatgc TGTCAATCAGAGGGGGATTTGTCT agaat
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 17.36
Model logo: def.2.model.LGO.gif
Sequence logo: def.2.LGO.gif
Sequence Alignment: def.2.ALGN
Solution location in genomic coordinates: 3431224-3431244
Solution sequence with flanking nucleotides: agcct TAGCAATCTTTGCGATTGGTC agtga
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA SP TF VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 16.25
Model logo: def.3.model.LGO.gif
Sequence logo: def.3.LGO.gif
Sequence Alignment: def.3.ALGN
Solution location in genomic coordinates: 3431297-3431320
Solution sequence with flanking nucleotides: atctt TCTAACTCCTGAACACATCTCTGG agatt
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page