degS Gene Page

Genbank name: degS
EcoGene name: degS
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST VC YP
EcoGene link: EG11652

Species that contributed to the solution: EC PA SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 19.01
Model logo: degS.1.model.LGO.gif
Sequence logo: degS.1.LGO.gif
Sequence Alignment: degS.1.ALGN
Solution location in genomic coordinates: 3379780-3379803
Solution sequence with flanking nucleotides: tgatg TCCGGTTAACTCGTGGTATGCTGC tgccg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: degQ_degS_IR Overlap: 10

Species that contributed to the solution: AA EC HI SP ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 16.81
Model logo: degS.2.model.LGO.gif
Sequence logo: degS.2.LGO.gif
Sequence Alignment: degS.2.ALGN
Solution location in genomic coordinates: 3379753-3379776
Solution sequence with flanking nucleotides: tcgta AACCGGGCATCAGGCTTACGTGTG atgtc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: degQ_degS_IR Overlap: 24

Species that contributed to the solution: AA EC HI SP ST YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 10.99
Model logo: degS.3.model.LGO.gif
Sequence logo: degS.3.LGO.gif
Sequence Alignment: degS.3.ALGN
Solution location in genomic coordinates: 3379775-3379798
Solution sequence with flanking nucleotides: acgtg TGATGTCCGGTTAACTCGTGGTAT gctgc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: degQ_degS_IR Overlap: 15
Solution location in genomic coordinates: 3379808-3379831
Solution sequence with flanking nucleotides: ctgcc GTTCCCTTTTTTAATGACGCCTCC atc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page