deoC Gene Page

Genbank name: deoC
EcoGene name: deoC
Divergent gene: yjjI
Species with an ortholog: EC   SP   ST   VC   YP
EcoGene link: EG10221    Reported site,genomic coordinates and site type: DPInteract 4614796:4614817 crp
   Reported site,genomic coordinates and site type: DPInteract 4614743:4614764 crp
   Reported site,genomic coordinates and site type: DPInteract 4614768:4614785 cytR
   Reported site,genomic coordinates and site type: DPInteract 4614832:4614847 deoR
   Reported site,genomic coordinates and site type: DPInteract 4614233:4614248 deoR
   Reported site,genomic coordinates and site type: DPInteract 4613954:4613969 deoR

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 22.96
Model logo: deoC.1.model.LGO.gif
Sequence logo: deoC.1.LGO.gif
Sequence Alignment: deoC.1.ALGN
Solution location in genomic coordinates: 4614744-4614763
Solution sequence with flanking nucleotides: tgaat TATTTGAACCAGATCGCATT acagt
Number of overlapping basepairs with reported site: 20
Site type: crp
Solution location in genomic coordinates: 4614797-4614816
Solution sequence with flanking nucleotides: cctta ATTGTGATGTGTATCGAAGT gtgtt
Number of overlapping basepairs with reported site: 20
Site type: crp

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 11.39
Model logo: deoC.2.model.LGO.gif
Sequence logo: deoC.2.LGO.gif
Sequence Alignment: deoC.2.ALGN
Solution location in genomic coordinates: 4614832-4614847
Solution sequence with flanking nucleotides: gtaga TGTTAGAATACTAACA aactc
Number of overlapping basepairs with reported site: 16
Site type: deoR

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 7.49
Model logo: deoC.3.model.LGO.gif
Sequence logo: deoC.3.LGO.gif
Sequence Alignment: deoC.3.ALGN
Solution location in genomic coordinates: 4614848-4614866
Solution sequence with flanking nucleotides: taaca AACTCGCAAGGTGAATTTT attgg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page