deoD Gene Page

Genbank name: deoD
EcoGene name: deoD
Divergent gene:
Species with an ortholog: AA EC HI SP ST VC YP
EcoGene link: EG10222

Species that contributed to the solution: EC HI SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 9.51
Model logo: deoD.1.model.LGO.gif
Sequence logo: deoD.1.LGO.gif
Sequence Alignment: deoD.1.ALGN
Solution location in genomic coordinates: 4618433-4618449
Solution sequence with flanking nucleotides: ttatg TCACAAAAAGGATAAAA ca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.38
Model logo: deoD.2.model.LGO.gif
Sequence logo: deoD.2.LGO.gif
Sequence Alignment: deoD.2.ALGN
Solution location in genomic coordinates: 4618402-4618425
Solution sequence with flanking nucleotides: ggatt TGGGCGGAGCGTTGACTCCGCCTT tgtta
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page