deoR Gene Page

Genbank name: deoR
EcoGene name: deoR
Divergent gene:
Species with an ortholog: AA EC ST YP
EcoGene link: EG10223

Species that contributed to the solution: AA EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 7.87
Model logo: deoR.1.model.LGO.gif
Sequence logo: deoR.1.LGO.gif
Sequence Alignment: deoR.1.ALGN
Solution location in genomic coordinates: 881966-881988 R
Solution sequence with flanking nucleotides: ttgag CGGCTCGCTTCAATAACTATTCA gaggg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 2.53
Model logo: deoR.2.model.LGO.gif
Sequence logo: deoR.2.LGO.gif
Sequence Alignment: deoR.2.ALGN
Solution location in genomic coordinates: 881989-882006 R
Solution sequence with flanking nucleotides: ctgct AAAAAGTGTAGTATTGAG cggct
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page