dfp Gene Page

Genbank name: dfp
EcoGene name: dfp
Divergent gene: radC
Species with an ortholog: EC HI PA ST
EcoGene link: EG10004

Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 7.15
Model logo: dfp.1.model.LGO.gif
Sequence logo: dfp.1.LGO.gif
Sequence Alignment: dfp.1.ALGN
Solution location in genomic coordinates: 3810256-3810273
Solution sequence with flanking nucleotides: caatc CTGGAAAGCGCCTCGCAA agtga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 5.69
Model logo: dfp.2.model.LGO.gif
Sequence logo: dfp.2.LGO.gif
Sequence Alignment: dfp.2.ALGN
Solution location in genomic coordinates: 3810221-3810244
Solution sequence with flanking nucleotides: gtcat AGCCGTTTCGTTAAATCGACGGCC agttt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 0.41
Model logo: dfp.3.model.LGO.gif
Sequence logo: dfp.3.LGO.gif
Sequence Alignment: dfp.3.ALGN
Solution location in genomic coordinates: 3810198-3810217
Solution sequence with flanking nucleotides: ctcct TTGTGGTGCTCGCATCCTGT catag
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page