dgkA Gene Page
Genbank name: dgkA
EcoGene name: dgkA
Divergent gene: plsB
Species with an ortholog:
AA EC HI PA SP ST VC YP
EcoGene link: EG10224
Species that contributed to the solution: AA EC HI ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 15.35
Model logo: dgkA.1.model.LGO.gif
Sequence logo: dgkA.1.LGO.gif
Sequence Alignment: dgkA.1.ALGN
Solution location in genomic coordinates: 4254184-4254204
Solution sequence with flanking nucleotides: ctgat ATTGACGCTCATAATGTAAAA aggtt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI SP ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 9.67
Model logo: dgkA.2.model.LGO.gif
Sequence logo: dgkA.2.LGO.gif
Sequence Alignment: dgkA.2.ALGN
Solution location in genomic coordinates: 4254115-4254136
Solution sequence with flanking nucleotides: aattc TGTGGTATCCGCTCATGTTTCG cgcgg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI PA SP ST VC YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 1
Map value: 7.63
Model logo: dgkA.3.model.LGO.gif
Sequence logo: dgkA.3.LGO.gif
Sequence Alignment: dgkA.3.ALGN
Solution location in genomic coordinates: 4254142-4254161
Solution sequence with flanking nucleotides: cgcgg CGCTACGCAAACCCGAATCA tcgga
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page