dgt Gene Page

Genbank name: dgt
EcoGene name: dgt
Divergent gene: pfs
Species with an ortholog: AA   EC   PA   ST   YP   
EcoGene link: EG10225

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 14.14
Model logo: dgt.1.model.LGO.gif
Sequence logo: dgt.1.LGO.gif
Sequence Alignment: dgt.1.ALGN
Solution location in genomic coordinates: 179196-179217
Solution sequence with flanking nucleotides: ttacc ATGCGCTTACGGGGAAGCGTAT ttctc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 9.38
Model logo: dgt.2.model.LGO.gif
Sequence logo: dgt.2.LGO.gif
Sequence Alignment: dgt.2.ALGN
Solution location in genomic coordinates: 179218-179233
Solution sequence with flanking nucleotides: cgtat TTCTCACGCGGGAGAG gac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.67
Model logo: dgt.3.model.LGO.gif
Sequence logo: dgt.3.LGO.gif
Sequence Alignment: dgt.3.ALGN
Solution location in genomic coordinates: 179155-179173
Solution sequence with flanking nucleotides: a GATTTACTCGCGATAAGCC cgatt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page