dinG Gene Page

Genbank name: dinG
EcoGene name: dinG
Divergent gene: ybiA
Species with an ortholog: EC PA SP ST VC YP
EcoGene link: EG11357 Reported site,genomic coordinates and site type: DPInteract 832259:832278 lexA

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 8.52
Model logo: dinG.1.model.LGO.gif
Sequence logo: dinG.1.LGO.gif
Sequence Alignment: dinG.1.ALGN
Solution location in genomic coordinates: 832209-832225
Solution sequence with flanking nucleotides: gccgc TTTCCAGAAACAGAAAA accat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 8.26
Model logo: dinG.2.model.LGO.gif
Sequence logo: dinG.2.LGO.gif
Sequence Alignment: dinG.2.ALGN
Solution location in genomic coordinates: 832247-832270
Solution sequence with flanking nucleotides: accga AAAATGCCACAATATTGGCTGTTT ataca
Number of overlapping basepairs with reported site: 12
Site type: lexA

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 7.06
Model logo: dinG.3.model.LGO.gif
Sequence logo: dinG.3.LGO.gif
Sequence Alignment: dinG.3.ALGN
Solution location in genomic coordinates: 832179-832202
Solution sequence with flanking nucleotides: taaac CGCATTATGTTGGTGGTTATTGCG agccg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page