dinP Gene Page

Genbank name: dinP
EcoGene name: dinB
Divergent gene:
Species with an ortholog: EC PA SP ST TF VC YP
EcoGene link: EG13141

Species that contributed to the solution: EC PA SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 35.33
Model logo: dinP.1.model.LGO.gif
Sequence logo: dinP.1.LGO.gif
Sequence Alignment: dinP.1.ALGN
Solution location in genomic coordinates: 250865-250882
Solution sequence with flanking nucleotides: aaatc ACTGTATACTTTACCAGT gttga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 12.05
Model logo: dinP.2.model.LGO.gif
Sequence logo: dinP.2.LGO.gif
Sequence Alignment: dinP.2.ALGN
Solution location in genomic coordinates: 250827-250847
Solution sequence with flanking nucleotides: ta AATGCTGAATCTTTACGCATT tctca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 250865-250885
Solution sequence with flanking nucleotides: aaatc ACTGTATACTTTACCAGTGTT gagag
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page