div Gene Page

Genbank name: div
EcoGene name: flk
Divergent gene: pdxB
Species with an ortholog: EC   ST   YP   
EcoGene link: EG10229

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.58
Model logo: div.1.model.LGO.gif
Sequence logo: div.1.LGO.gif
Sequence Alignment: div.1.ALGN
Solution location in genomic coordinates: 2435895-2435914
Solution sequence with flanking nucleotides: agacg AGAGTTAACCGGACAAGTGT gccat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 7.67
Model logo: div.2.model.LGO.gif
Sequence logo: div.2.LGO.gif
Sequence Alignment: div.2.ALGN
Solution location in genomic coordinates: 2435875-2435892
Solution sequence with flanking nucleotides: gtt TGTGTTACCTGTATGAGA cgaga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 6.58
Model logo: div.3.model.LGO.gif
Sequence logo: div.3.LGO.gif
Sequence Alignment: div.3.ALGN
Solution location in genomic coordinates: 2435948-2435968
Solution sequence with flanking nucleotides: cgaag ATTTCAGGTATAAGGATACGT a
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page