dksA Gene Page

Genbank name: dksA
EcoGene name: dksA
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   VC   YP   
EcoGene link: EG10230

Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 38.04
Model logo: dksA.1.model.LGO.gif
Sequence logo: dksA.1.LGO.gif
Sequence Alignment: dksA.1.ALGN
Solution location in genomic coordinates: 160656-160677 R
Solution sequence with flanking nucleotides: aaaag CATCTGCTATTTATAGCGGCCT cattt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 17.18
Model logo: dksA.2.model.LGO.gif
Sequence logo: dksA.2.LGO.gif
Sequence Alignment: dksA.2.ALGN
Solution location in genomic coordinates: 160708-160729 R
Solution sequence with flanking nucleotides: cgctt TTCCTCACACAGTTGTCAAGTG ttacg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 12.65
Model logo: dksA.3.model.LGO.gif
Sequence logo: dksA.3.LGO.gif
Sequence Alignment: dksA.3.ALGN
Solution location in genomic coordinates: 160637-160654 R
Solution sequence with flanking nucleotides: gcctc ATTTTTCCCCCGAACATG gggat
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page