dmsA Gene Page

Genbank name: dmsA
EcoGene name: dmsA
Divergent gene:
Species with an ortholog: EC   HI   ST   YP
EcoGene link: EG10232    Reported site,genomic coordinates and site type: DPInteract 940085:940108 modE
   Reported site,genomic coordinates and site type: DPInteract 940036:940051 narL

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 24.96
Model logo: dmsA.1.model.LGO.gif
Sequence logo: dmsA.1.LGO.gif
Sequence Alignment: dmsA.1.ALGN
Solution location in genomic coordinates: 939948-939971
Solution sequence with flanking nucleotides: atacc CAATTTTTCTGAATCTAAAAAGCG cctgc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: TERM15 Overlap: 11
Repeat: serS_dmsA_IR Overlap: 8
Solution location in genomic coordinates: 940085-940108
Solution sequence with flanking nucleotides: ttatt CGATGTATACAAGCCTATATAGCG aactg
Number of overlapping basepairs with reported site: 24
Site type: modE

Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 13.80
Model logo: dmsA.2.model.LGO.gif
Sequence logo: dmsA.2.LGO.gif
Sequence Alignment: dmsA.2.ALGN
Solution location in genomic coordinates: 940231-940249
Solution sequence with flanking nucleotides: tcgcc GTGGTTTGGTAAAAACGAC agcga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 8.98
Model logo: dmsA.3.model.LGO.gif
Sequence logo: dmsA.3.LGO.gif
Sequence Alignment: dmsA.3.ALGN
Solution location in genomic coordinates: 940134-940150
Solution sequence with flanking nucleotides: cacaa TACGGTTTGTTACTGGA atcaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 940176-940192
Solution sequence with flanking nucleotides: agtga GCCATTATGAAAACGAA aatcc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page