dnaA Gene Page
Genbank name: dnaA
EcoGene name: dnaA
Divergent gene: rpmH
Species with an ortholog:
EC HI PA SP ST TF VC YP
EcoGene link: EG10235
Reported site,genomic coordinates and site type: DPInteract 3881565:3881579 dnaA
Reported site,genomic coordinates and site type: PMID:10545126 3881544:3881558 dnaA
Reported site,genomic coordinates and site type: PMID:8825783 3881634:3881664 argP
Reported site,genomic coordinates and site type: PMID:8825783 3881369:3881414 argP
Reported site,genomic coordinates and site type: PMID:8830699 3881523:3881551 fis
Species that contributed to the solution: EC HI SP ST TF YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 18.05
Model logo: dnaA.1.model.LGO.gif
Sequence logo: dnaA.1.LGO.gif
Sequence Alignment: dnaA.1.ALGN
Solution location in genomic coordinates: 3881691-3881710 R
Solution sequence with flanking nucleotides: agcgc AAGGATCGTCCTGGATCTTT attag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3881397-3881416 R
Solution sequence with flanking nucleotides: acgtc AACAATCATGAATGTTTCAG cctta
Number of overlapping basepairs with reported site: 18
Site type: argP
Species that contributed to the solution: EC HI SP ST TF VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 14.51
Model logo: dnaA.2.model.LGO.gif
Sequence logo: dnaA.2.LGO.gif
Sequence Alignment: dnaA.2.ALGN
Solution location in genomic coordinates: 3881497-3881514 R
Solution sequence with flanking nucleotides: atgat CCGCGGTCCCGATCGTTT tgcag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3881400-3881417 R
Solution sequence with flanking nucleotides: tacgt CAACAATCATGAATGTTT cagcc
Number of overlapping basepairs with reported site: 15
Site type: argP
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 12.19
Model logo: dnaA.3.model.LGO.gif
Sequence logo: dnaA.3.LGO.gif
Sequence Alignment: dnaA.3.ALGN
Solution location in genomic coordinates: 3881456-3881472 R
Solution sequence with flanking nucleotides: catat AACCGCAGACAGCGGTT cgtgc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page