dnaB Gene Page
Genbank name: dnaB
EcoGene name: dnaB
Divergent gene: qor
Species with an ortholog:
AA EC HI PA SP ST VC YP
EcoGene link: EG10236
Species that contributed to the solution: AA EC HI VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 11.04
Model logo: dnaB.1.model.LGO.gif
Sequence logo: dnaB.1.LGO.gif
Sequence Alignment: dnaB.1.ALGN
Solution location in genomic coordinates: 4261820-4261839
Solution sequence with flanking nucleotides: cctcc AGAACGTATCGTCAGGGTCT gcttc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4261850-4261869
Solution sequence with flanking nucleotides: atatg ATAAAGTTTCGACCCATTCT ttatc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 6.16
Model logo: dnaB.2.model.LGO.gif
Sequence logo: dnaB.2.LGO.gif
Sequence Alignment: dnaB.2.ALGN
Solution location in genomic coordinates: 4261871-4261888
Solution sequence with flanking nucleotides: ttctt TATCTCGGTAACTCCATT cact
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page