dnaG Gene Page
Genbank name: dnaG
EcoGene name: dnaG
Divergent gene:
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10239
Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 28.21
Model logo: dnaG.1.model.LGO.gif
Sequence logo: dnaG.1.LGO.gif
Sequence Alignment: dnaG.1.ALGN
Solution location in genomic coordinates: 3208696-3208719
Solution sequence with flanking nucleotides: cttcc GAAAGGAATGCGCGGCTTATTTTC gttta
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA SP ST TF VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 21.78
Model logo: dnaG.2.model.LGO.gif
Sequence logo: dnaG.2.LGO.gif
Sequence Alignment: dnaG.2.ALGN
Solution location in genomic coordinates: 3208680-3208695
Solution sequence with flanking nucleotides: tagtt GTAAGGCCGTGCTTCC gaaag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3208700-3208715
Solution sequence with flanking nucleotides: cgaaa GGAATGCGCGGCTTAT tttcg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC PA ST TF VC
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 9.10
Model logo: dnaG.3.model.LGO.gif
Sequence logo: dnaG.3.LGO.gif
Sequence Alignment: dnaG.3.ALGN
Solution location in genomic coordinates: 3208636-3208657
Solution sequence with flanking nucleotides: t AATTCCCCGAGAGCGTTGCTCT ccgat
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page