dnaJ Gene Page
Genbank name: dnaJ
EcoGene name: dnaJ
Divergent gene:
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10240
Species that contributed to the solution: AA EC HI PA SP VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 19.89
Model logo: dnaJ.1.model.LGO.gif
Sequence logo: dnaJ.1.LGO.gif
Sequence Alignment: dnaJ.1.ALGN
Solution location in genomic coordinates: 14109-14130
Solution sequence with flanking nucleotides: ctgac ACGGGCGAAGGGGAATTTCCTC tccgc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: dnaK_dnaJ_IR     Overlap: 22
Species that contributed to the solution: AA EC HI ST TF YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 15.03
Model logo: dnaJ.2.model.LGO.gif
Sequence logo: dnaJ.2.LGO.gif
Sequence Alignment: dnaJ.2.ALGN
Solution location in genomic coordinates: 14080-14096
Solution sequence with flanking nucleotides: taa TCGCCCTATAAACGGGT aatta
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 8.60
Model logo: dnaJ.3.model.LGO.gif
Sequence logo: dnaJ.3.LGO.gif
Sequence Alignment: dnaJ.3.ALGN
Solution location in genomic coordinates: 14078-14100
Solution sequence with flanking nucleotides: t AATCGCCCTATAAACGGGTAATT atact
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 14103-14125
Solution sequence with flanking nucleotides: attat ACTGACACGGGCGAAGGGGAATT tcctc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: dnaK_dnaJ_IR     Overlap: 18
Gene Index Page