dnaK Gene Page

Genbank name: dnaK
EcoGene name: dnaK
Divergent gene: yaaI
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10241

Species that contributed to the solution: AA EC HI PA SP ST VC YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 1
Map value: 26.13
Model logo: dnaK.1.model.LGO.gif
Sequence logo: dnaK.1.LGO.gif
Sequence Alignment: dnaK.1.ALGN
Solution location in genomic coordinates: 11986-12007
Solution sequence with flanking nucleotides: cgcaa AAGCACAAAAAATTTTTGCATC tcccc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA SP ST TF VC
Total number of sites in the solution: 13
Number of E. coli sites in the solution: 2
Map value: 20.78
Model logo: dnaK.2.model.LGO.gif
Sequence logo: dnaK.2.LGO.gif
Sequence Alignment: dnaK.2.ALGN
Solution location in genomic coordinates: 11876-11898
Solution sequence with flanking nucleotides: tttct TTTTATTACAATTTTTTGATGAA tgcct
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 11964-11986
Solution sequence with flanking nucleotides: ctgcc ATATCGCGAAATTTCTGCGCAAA agcac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA SP ST TF VC YP
Total number of sites in the solution: 15
Number of E. coli sites in the solution: 2
Map value: 15.40
Model logo: dnaK.3.model.LGO.gif
Sequence logo: dnaK.3.LGO.gif
Sequence Alignment: dnaK.3.ALGN
Solution location in genomic coordinates: 12006-12026
Solution sequence with flanking nucleotides: ttgca TCTCCCCCTTGATGACGTGGT ttacg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 12123-12143
Solution sequence with flanking nucleotides: gactc ACAACCACATGATGACCGAAT atata
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page