dnaQ Gene Page

Genbank name: dnaQ
EcoGene name: dnaQ
Divergent gene: rnhA
Species with an ortholog: EC HI PA SP ST TF VC YP
EcoGene link: EG10243

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 20.16
Model logo: dnaQ.1.model.LGO.gif
Sequence logo: dnaQ.1.LGO.gif
Sequence Alignment: dnaQ.1.ALGN
Solution location in genomic coordinates: 236004-236020
Solution sequence with flanking nucleotides: c TCTGGTAGACTTCCTGT aattg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 236050-236066
Solution sequence with flanking nucleotides: aagtc TGACATAAATGACCGCT
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 3.37
Model logo: dnaQ.2.model.LGO.gif
Sequence logo: dnaQ.2.LGO.gif
Sequence Alignment: dnaQ.2.ALGN
Solution location in genomic coordinates: 236024-236043
Solution sequence with flanking nucleotides: gtaat TGAATCGAACTGTAAAACGA caagt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page