dnaX Gene Page

Genbank name: dnaX
EcoGene name: dnaX
Divergent gene:
Species with an ortholog: AA EC PA SP ST TF VC YP
EcoGene link: EG10245

Species that contributed to the solution: EC ST TF
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 7.43
Model logo: dnaX.1.model.LGO.gif
Sequence logo: dnaX.1.LGO.gif
Sequence Alignment: dnaX.1.ALGN
Solution location in genomic coordinates: 491296-491312
Solution sequence with flanking nucleotides: ccttc CAGCGTTTCAGAGCCTG cca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST TF YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 6.22
Model logo: dnaX.2.model.LGO.gif
Sequence logo: dnaX.2.LGO.gif
Sequence Alignment: dnaX.2.ALGN
Solution location in genomic coordinates: 491257-491277
Solution sequence with flanking nucleotides: ctgac GGGGCTGTGTTAGCATTACCC cttcg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 5.59
Model logo: dnaX.3.model.LGO.gif
Sequence logo: dnaX.3.LGO.gif
Sequence Alignment: dnaX.3.ALGN
Solution location in genomic coordinates: 491239-491254
Solution sequence with flanking nucleotides: gcatt CAGCCTCGCCGTTCTG acggg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page